12 KiB
source: "D:\个人文档\PROJECTS\RGC-ADOA\ref\sciadv.adx7815_sm.pdf" pdf_type: text_based pages: 16 converted: 2026-09-17
目录（TOC）
Supplementary Materials for— 行 18–19（part01）Disrupted energy metabolism is associated with retinal ganglion cell degeneration in autosomal dominant optic atrophy— 行 20–26（part01）The PDF file includes:— 行 27–29（part01）Other Supplementary Material for this manuscript includes the following:— 行 30–176（part01）Captions for the Supplementary Excel Files. Pathway enrichment analyses for retinal cell types.— 行 177–178（part01）
Supplementary Materials for
Disrupted energy metabolism is associated with retinal ganglion cell degeneration in autosomal dominant optic atrophy
Eugene Yu-Chuan Kang et al.
Corresponding author: Chi-Neu Tsai, pink7@mail.cgu.edu.tw; Chyuan-Sheng Lin, csl5@cumc.columbia.edu; Nan-Kai Wang, wang.nankai@gmail.com
Sci. Adv. 12 , eadx7815 (2026) DOI: 10.1126/sciadv.adx7815
The PDF file includes:
Figs. S1 to S9 Tables S1 to S4 Legends for supplementary Excel files
Other Supplementary Material for this manuscript includes the following:
Supplementary Excel files
Fig. S1. Hunched-back posture observed in Opa1****V291D/+ mice.
Representative photograph showing the characteristic hunched-back posture in Opa1__V291D/+ mice at 220 days.
Fig. S2. Mitochondrial morphological and ultrastructural alterations in the optic nerve and retinal ganglion cells (RGCs) of Opa1****V291D/+ mice.
(A) Representative confocal images of mKate-labeled mitochondria across the prelaminar region, unmyelinated optic nerve head, and myelinated optic nerve in wild-type (WT) and Opa1__V291D/+ mice. Quantitative analysis revealed significantly increased mitochondrial sphericity and reduced morphological variability in Opa1__V291D/+ mice across all regions. ( n = 3–4 mice per group; ** P < 0.01, *** P < 0.001, **** P < 0.0001).
(B) Transmission electron microscopy (TEM) images of RGC somata in the ganglion cell layer showing normal mitochondrial morphology in the WT retina and fragmented, vacuolated mitochondria with loss of cristae (arrowheads) and accumulation of autophagosomes (arrows) in Opa1__V291D/+ retinas. N, nucleus.
Fig. S3. Analysis of mitochondrial DNA (mtDNA) integrity and copy number in retinas of Opa1****V291D/+ and wild-type (WT) mice.
( A ) Quantitative PCR analysis of mtDNA copy number revealed a significant increase in Opa1__V291D/+ retinas compared with WT controls, suggesting enhanced mitochondrial fission and compensatory mitochondrial turnover. Data are presented as mean ± SEM ( n = 3 mice per group); * P < 0.05.
( B ) Assessment of mtDNA integrity using qPCR-based mtDNA damage assay and long-extension PCR showed no detectable differences in mtDNA deletions or damage between Opa1__V291D/+ and WT retinas, indicating preserved mtDNA stability.
Fig. S4. Western blot analysis of long (l-OPA1) and short (s-OPA1) isoforms in retinas of Opa1****V291D/+ and wild-type ( WT ) mice.
Representative immunoblot and quantification showing significantly reduced levels of both l-OPA1 and s-OPA1 isoforms in Opa1__V291D/+ retinas compared with WT controls ( n = 6 mice per group). The reduction was more pronounced in the short (soluble) form. Data are presented as mean ± SEM. ** P < 0.01, **** P < 0.0001.
Fig. S5. Differential expression of genes involved in metabolic and mitochondrial quality-control pathways in RGCs of Opa1****V291D/+ retinas. ( A ) Heat maps of the snRNA-seq data showing the expression levels of genes associated with pyruvate metabolism & the citric acid cycle, mitophagy, and autophagy pathways in the RGC-2 cluster from Opa1__V291D/+ mice compared with wild-type ( WT) controls at 360 days. ( n = 5 mice per group; adjusted P = 0.0288, 0.0075, and 0.0002, respectively; WikiPathways database)
( B ) Heat maps of the spatial transcriptomic analysis showing the expression levels of genes associated with mitophagy and autophagy pathways in RGCs of Opa1__V291D/+ mice compared with WT at 280 days ( n = 1 mouse retina per group; adjusted P = 0.1542 and < 0.0001, respectively; REACTOME database)
Fig. S6. Analysis of integrated stress response (ISR) in V291D-VG2-MitoTag - MitoLbNOX mice. Representative immunostaining images of NRF2, eIF2α, phospho-eIF2α (p-eIF2α), and ATF4 in retinal sections from wild-type ( WT ), V291D-VG2-MitoTag , and V291D-VG2-MitoTag - MitoLbNOX mice. Analysis of the fluorescence intensity of NRF2 ( n = 4 mice per group; one‐way ANOVA with Tukey’s test P = 0.0026, 0.7637, and 0.0072, for WT compared to V291D-VG2-MitoTag , WT compared to V291D-VG2-MitoTag - MitoLbNOX , and V291D-VG2-MitoTag compared to V291D-VG2-MitoTag - MitoLbNOX , respectively), eIF2α ( P = 0.8994, 0.1517, and 0.2840), p-eIF2α ( P = 0.3041, 0.6293, and 0.0766), and ATF4 ( P = 0.1046, 0.2983, and 0.7557) immunostaining in the ganglion cell layer. Data are presented as mean ± SEM. ** P < 0.01. ns: non-significant
Fig. S7. Representative matrix-assisted laser desorption/ionization (MALDI) mass spectrometry images from V291D-VG2-MitoTag and V291D-VG2-MitoTag-MitoLbNOX mouse retinas. Representative MALDI imaging results and corresponding bar charts demonstrating the ATP signal intensity in positive ion mode ( n = 3 per group; independent t -test P = 0.0331), AMP signal intensity in negative ion mode ( P = 0.2382), and G-6-P signal intensity in negative ion mode ( P = 0.3115) in the inner retinal layer of mouse retinas at 100 days.
Fig. S8. Assessment of Complex I subunit abundance and supercomplex assembly in Opa1****V291D/+ retinas.
( A ) SDS–PAGE immunoblotting of retinal lysates from wild-type ( WT) and Opa1__V291D/+ mice showing protein levels of the representative Complex I subunits NDUFS3 and NDUFA9. Quantification revealed no significant differences between genotypes, indicating preserved steady-state abundance of these subunits at the whole retina level.
( B ) Blue-native PAGE (BN-PAGE) followed by immunoblotting with antibodies against NDUFS3 and NDUFA9 to assess Complex I assembly and supercomplex formation. While the abundance of fully assembled Complex I did not differ significantly between WT and Opa1__V291D/+ retinas, a trend toward reduced levels of Complex I–containing supercomplexes was observed in Opa1__V291D/+ samples with both antibodies (NDUFS3: P = 0.0529; NDUFA9: P = 0.0867). No abnormal or partially assembled Complex I subcomplexes were detected. ( n = 4 mice per group)
Fig. S9. Optical coherence tomography (OCT) imaging and retinal thickness analysis in mouse retinas.
(A) Representative Bioptigen OCT images showing dynamic scan control (left), horizontal B-scan alignment (middle), and vertical B-scan alignment (right).
(B) Heat maps and thickness analyses of the total retina (top row) and retinal nerve fiber layer (RNFL; bottom row). For each layer, representative maps include the raw heat map, heat map showing values above two standard deviations, segmented vitreoretinal interface (VIP) image, and the corresponding average thickness map across the Early Treatment Diabetic Retinopathy Study (ETDRS) sectors.
Table S1. Aggregated data on the pathogenicity of the OPA1****V346D variant.
| Evidence | Pathogenicity | Details |
|---|---|---|
| In-silico Prediction | Pathogenic Strong | PP3,MetaRNN score: 0.975 |
| Population Database | Pathogenic Moderate | PM2, the variant is absent from gnomAD databases |
| Protein Effect | Pathogenic Moderate | PM5, another variant at the same position, Val346Leu,is classified as likely pathogenic |
| Variant Location | Pathogenic Moderate | PM1; located in a hot-spot with 13 missense/in- frame variants,11 of which arepathogenic |
| Prediction Tools | ||
| AlphaMissense | StrongPathogenic | 0.9997 |
| MutPred | StrongPathogenic | 0.863 |
| REVEL | StrongPathogenic | 0.985 |
| MetaLR | Moderatepathogenic | 0.958 |
| SIFT | Supporting pathogenic | 0 |
Table S2. Primers used in the study.
| Oligonucleotides | Sequence (5’-3’) |
|---|---|
| Genotyping | |
| _Opa1_Forward | AGAGCTGAGAGGGAGTGAAGAGAGG |
| _Opa1_Reverse | CCCAAAACTCCTTTATCCCAGTGAC |
| Quantitative real-time | PCR |
| _Opa1_Forward | GGAAAGGAACACGACGACATA |
| _Opa1_Reverse | TCAAGCTATCCTCGGCAAAG |
| _Actb_Forward | GAGGTATCCTGACCCTGAAGTA |
| _Actb_Reverse | GCTCGA AGTCTAGAGCAACATAG |
| Long extension PCR | for mitochondrial DNA damage |
| _mtDNA_Forward | CATAGTGGGGTATCTAATCCCA |
| _mtDNA_Reverse | CCTACTAGCAATTATCCCCA |
Table S3. Cell markers for cell type annotation in single-nucleus RNA sequencing
| **Cell type ** | Genes |
|---|---|
| Rodphotoreceptors | Cnga1, Cngb1, Gnat1, Rho, Rp1, Sag, Ush2a |
| Conephotoreceptors | Arr3, Cngb3, Gnat2, Opn1mw |
| Retinalganglion cells | _Rbpms, Slc17a6, Thy1 _ |
| Amacrine cells | Gad1, Gad2, Grm5, Slc6a5, Tfap2b |
| Muller cells | Rlbp1, Slc1a3 |
| Uveal cells | _Gpnmb, Tyr _ |
| Bipolar cells | Cabp5, Grm6, Kcnb2, Prkca |
| Horizontal cells | Lhx1, Onecut2, Prox1 |
| Pericytes | Pdgfrb, Rgs5 |
Table S4. Antibodies and materials used for Western blotting (WB) and Immunofluorescence (IF).
| Item | Dilution and Application | Source |
|---|---|---|
| BRN3A | 1:50(IF) | Millipore MAB1585 |
| OPA1 | 1:1000(WB) | Proteintech 27733-1-AP |
| β-actin | 1:2000(WB) | Proteintech HRP-60008 |
| GAPDH | 1:1000(WB) | Cell Signaling#2118 |
| p-AMPKα | 1:50(IF) | Cell Signaling#2535 |
| PFKFB3 | 1:1000(WB) | Proteintech 13763-1-AP |
| p-PFKFB3 | 1:500(WB),1:50(IF) | ThermoFisher #PA5-114619 |
| GLUT1 | 1:2000(WB), 1:2500(IF) | Proteintech 21829-1-AP |
| p-GLUT1 | 1:200(WB) | Millipore ABN991 |
| Hexokinase 1 (HK1) | 1:1000(WB), 1:800(IF) | Cell Signaling #2024 |
| Hexokinase 2(HK2) | 1:5000(WB) | Proteintech 22029-1-AP |
| LDHB | 1:50(IF) | Proteintech 14824-1-AP |
| 4-Hydroxynonenal antibody (4-HNE) | 1:25(IF) | Abcam ab48506 |
| PDHE1 | 1:50(IF) | Proteintech 18068-1-AP |
| IDH3 | 1:200(IF) | Proteintech 15909-1-AP |
| RBPMS | 1:200(IF) | Millipore ABN1362 |
| GFP | 1:2000(IF) | Aveslabs GFP-1020 |
| Hoechst Nucleic Acid | 1:1000(IF) | Thermo Scientific 62249 |
| Donkey anti-mouse HRP | 1:5000(WB) | Invitrogen #A16017 |
| Donkeyanti-rabbit HRP | 1:5000(WB) | Invitrogen #31458 |
| Cy™2 AffiniPure Donkey Anti-Mouse IgG(H+L) | 1:200(IF) | Jackson ImmunoResearch 715-225-151 |
| Cy™3 AffiniPure Donkey Anti-Mouse IgG(H+L) | 1:200(IF) | Jackson ImmunoResearch 715-165-151 |
| Cy™2 AffiniPure Donkey Anti-Rabbit IgG(H+L) | 1:200(IF) | Jackson ImmunoResearch 711-225-152 |
| Cy™3 AffiniPure Donkey Anti-Rabbit IgG(H+L) | 1:200(IF) | Jackson ImmunoResearch 711-165-152 |
| Cy™2 AffiniPure™ | 1:200(IF) | Jackson ImmunoResearch 703-545-155 |
| Donkey Anti-Chicken IgG (H+L) | ||
|---|---|---|
| NuPAGE™ MOPS SDS | - Invitrogen | NP0001 |
| RunningBuffer | ||
| Bolt™ MES SDS Running | - Invitrogen | B000202 |
| Buffer | ||
| Novex™ Tris-Glycine SDS RunningBuffer | - Invitrogen | LC2675 |
| Novex™ Tris-Glycine SDS Sample Buffer | - Invitrogen | LC2676 |
| Bolt™ LDS Sample Buffer | - Invitrogen | B0007 |
| NuPAGE™ Sample | - Invitrogen | NP0004 |
| ReducingAgent | ||
| Bolt™ Sample Reducing | - Invitrogen | B0009 |
| Agent | ||
| Novex™ Tris-Glycine | - Invitrogen | XP00100PK2 |
| Mini Protein Gels, 10%, 1.0 mm | ||
| Bolt™ Bis-Tris Plus Mini | - Invitrogen | NW00122BOX |
| Protein Gels,12%,1.0 mm | ||
| Bolt™ Bis-Tris Plus Mini Protein Gels, 4-12%, 1.0 | - Invitrogen | NW04122BOX |
| mm | ||
| SuperKine™ Enhanced AntibodyDilution Buffer | - Abbkine | BMU103-EN |
| SuperKine™ West Femto | - Abbkine | BMU102-EN |
| Maximum Sensitivity | ||
| Substrate | ||
| SuperBlock (TBS) | - Thermo Sci | entific 37535 |
| BlockingBuffer | ||
| EveryBlot BlockingBuffer | - Bio-Rad | #12010020 |
| PageRuler™ Plus | - Thermo Sci | entific 26619 |
| Prestained Protein Ladder, 10 to 250 kDa |
Captions for the Supplementary Excel Files. Pathway enrichment analyses for retinal cell types.
The archive contains Gene Ontology (GO), KEGG, Reactome, and WikiPathways enrichment analysis results derived from differential gene expression analyses of individual retinal cell types, including cone photoreceptors, rod photoreceptors, retinal ganglion cell cluster 1 (RGC-1), and retinal ganglion cell cluster 2 (RGC-2). Each Excel file lists pathways with corresponding gene sets, enrichment statistics, and adjusted P values.